99
|
Oxford Instruments
com imaris imaris rrid scr 007370 software Com Imaris Imaris Rrid Scr 007370 Software, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/com imaris imaris rrid scr 007370 software/product/Oxford Instruments Average 99 stars, based on 1 article reviews
com imaris imaris rrid scr 007370 software - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
96
|
New England Biolabs
snap cell 647 sir new england biolabs s9102 software matlab r2020a Snap Cell 647 Sir New England Biolabs S9102 Software Matlab R2020a, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/snap cell 647 sir new england biolabs s9102 software matlab r2020a/product/New England Biolabs Average 96 stars, based on 1 article reviews
snap cell 647 sir new england biolabs s9102 software matlab r2020a - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
an online tool An Online Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/an online tool/product/GenScript corporation Average 90 stars, based on 1 article reviews
an online tool - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
99
|
Bio-Rad
image lab software biorad rrid scr 014210 other bio rad chemidoctm touch system biorad Image Lab Software Biorad Rrid Scr 014210 Other Bio Rad Chemidoctm Touch System Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/image lab software biorad rrid scr 014210 other bio rad chemidoctm touch system biorad/product/Bio-Rad Average 99 stars, based on 1 article reviews
image lab software biorad rrid scr 014210 other bio rad chemidoctm touch system biorad - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
bcl2fastq Bcl2fastq, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bcl2fastq/product/Illumina Inc Average 90 stars, based on 1 article reviews
bcl2fastq - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
genscript bioinformatics software Genscript Bioinformatics Software, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/genscript bioinformatics software/product/GenScript corporation Average 90 stars, based on 1 article reviews
genscript bioinformatics software - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
sequence scramble online tool Sequence Scramble Online Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence scramble online tool/product/GenScript corporation Average 90 stars, based on 1 article reviews
sequence scramble online tool - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Gene Tools Inc
standard scrambled sequence 5’cctcttacctcagttacaatttata-3 Standard Scrambled Sequence 5’cctcttacctcagttacaatttata 3, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/standard scrambled sequence 5’cctcttacctcagttacaatttata-3/product/Gene Tools Inc Average 90 stars, based on 1 article reviews
standard scrambled sequence 5’cctcttacctcagttacaatttata-3 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Gene Tools Inc
standard scrambled sequence Standard Scrambled Sequence, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/standard scrambled sequence/product/Gene Tools Inc Average 90 stars, based on 1 article reviews
standard scrambled sequence - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
99
|
Sartorius AG
algorithm incucyte base analysis software sartorius rrid scr 019874 software Algorithm Incucyte Base Analysis Software Sartorius Rrid Scr 019874 Software, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/algorithm incucyte base analysis software sartorius rrid scr 019874 software/product/Sartorius AG Average 99 stars, based on 1 article reviews
algorithm incucyte base analysis software sartorius rrid scr 019874 software - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
random library tool Random Library Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/random library tool/product/GenScript corporation Average 90 stars, based on 1 article reviews
random library tool - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
86
|
InvivoGen
sirna wizard scramble tool Sirna Wizard Scramble Tool, supplied by InvivoGen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sirna wizard scramble tool/product/InvivoGen Average 86 stars, based on 1 article reviews
sirna wizard scramble tool - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |